Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Saccharomyces cerevisiae S288C Small Nucleolar RNA secondary structure diagram

Saccharomyces cerevisiae S288C Small Nucleolar RNA URS000013DDAE_559292

Automated summary: This snoRNA sequence is 204 nucleotides long and is found in Saccharomyces cerevisiae S288C. Annotated by 4 databases (ENA, IntAct, RefSeq, SGD). Has a conserved secondary structure or a structured region. Matches 1 Rfam family (snR5, RF01252). Saccharomyces cerevisiae S288C Small Nucleolar RNA sequence is a product of SNR5 gene. Found in the Saccharomyces cerevisiae S288C reference genome.

Interactions 15

According to IntAct, Saccharomyces cerevisiae S288C Small Nucleolar RNA interacts with:

Interaction id Participant Synonyms
EBI-10957317 URS00002D9DEC_559292 EBI-10921911 URS00002D9DEC_559292 snr24 yeast u24
EBI-10957329 URS000013DDAE_559292 EBI-10957299 URS000013DDAE_559292 snr5 yeast
EBI-16631828 P08518 B150 D6W2K8 DNA-directed RNA polymerase II 140 kDa polypeptide EBI-15767 P08518 Q12738 Q7Z9Y0 RPB150 RPB2 RPO22 YOR151C rpb2_yeast
EBI-10957296 P33322 CBF5 Centromere-binding factor 5 Centromere/microtubule-binding protein CBF5 D6VYH9 EBI-4105 H/ACA snoRNP protein CBF5 L9470.11 P33322 Small nucleolar RNP protein CBF5 YLR175W cbf5_yeast p64'
EBI-10957687 P33322 CBF5 Centromere-binding factor 5 Centromere/microtubule-binding protein CBF5 D6VYH9 EBI-4105 H/ACA snoRNP protein CBF5 L9470.11 P33322 Small nucleolar RNP protein CBF5 YLR175W cbf5_yeast p64'
EBI-10957698 P33322 CBF5 Centromere-binding factor 5 Centromere/microtubule-binding protein CBF5 D6VYH9 EBI-4105 H/ACA snoRNP protein CBF5 L9470.11 P33322 Small nucleolar RNP protein CBF5 YLR175W cbf5_yeast p64'
EBI-10958636 P38203 D6VPX4 EBI-180 LSM2 P38203 SMX5 SNP3 Small nuclear ribonucleoprotein D homolog SNP3 YBL026W YBL0425 lsm2_yeast
EBI-16631850 P38996 D6W3H8 EBI-11776 HMD1 NAB3 P38996 Q07034 YPL190C nab3_yeast
EBI-10958324 P40089 D3DM53 EBI-10236 LSM5 P40089 YER146W lsm5_yeast
EBI-10958648 P40089 D3DM53 EBI-10236 LSM5 P40089 YER146W lsm5_yeast
EBI-16631877 P53617 D6W0U2 EBI-12228 N0868 NRD1 P53617 YNL251C nrd1_yeast
EBI-10958362 P53905 D6W135 EBI-141 LSM7 N1202 N1780 P53905 YNL147W lsm7_yeast
EBI-10958298 P57743 D6VZ73 EBI-10227 LSM3 P57743 Q05176 Q06759 SMX4 SmX4 protein USS2 YLR438C-A lsm3_yeast
EBI-16631939 Q00416 D6VZ65 E9P9Z4 EBI-16945 L9576.1 Q00416 Q06448 SEN1 YLR430W sen1_yeast tRNA-splicing endonuclease positive effector
EBI-10958336 Q06406 D6VT10 D9481.18 EBI-196 LSM6 Q06406 YDR378C lsm6_yeast

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Localisation

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    AUCAUUCAAUAAACUGAUCUUCCGGAUUACCAUGCUUAAGACAUCACGCCUCCAUAUGUCUAUAUAAAGCGCAAAUGGCUGGAAGUAGACCAAUUUUUUUUGUUCCUAGCUUUUCAUUAUUGAAAUCUAAUCCAGUUUUAAUGGUUUUUCUUAAUUAAGAAAACAAAUUAUCAUUGGUUCGCUCUAGGUGUACAUAUCUUCACU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 42 other species

    1. Saccharomyces cerevisiae (baker's yeast) small nucleolar RNA snR5
    2. Saccharomyces cerevisiae Kyokai no. 7 K7_snR5
    3. Saccharomyces cerevisiae R103 SNR5
    4. Saccharomyces cerevisiae YJM1083 SNR5
    5. Saccharomyces cerevisiae YJM1133 SNR5
    6. Saccharomyces cerevisiae YJM1208 SNR5
    7. Saccharomyces cerevisiae YJM1248 SNR5
    8. Saccharomyces cerevisiae YJM1273 SNR5
    9. Saccharomyces cerevisiae YJM1326 SNR5
    10. Saccharomyces cerevisiae YJM1381 SNR5
    11. Saccharomyces cerevisiae YJM1385 SNR5
    12. Saccharomyces cerevisiae YJM1387 SNR5
    13. Saccharomyces cerevisiae YJM1388 SNR5
    14. Saccharomyces cerevisiae YJM1389 SNR5
    15. Saccharomyces cerevisiae YJM1400 SNR5
    16. Saccharomyces cerevisiae YJM1401 SNR5
    17. Saccharomyces cerevisiae YJM1402 SNR5
    18. Saccharomyces cerevisiae YJM1418 SNR5
    19. Saccharomyces cerevisiae YJM1434 SNR5
    20. Saccharomyces cerevisiae YJM1439 SNR5
    21. Saccharomyces cerevisiae YJM1443 SNR5
    22. Saccharomyces cerevisiae YJM1444 SNR5
    23. Saccharomyces cerevisiae YJM1450 SNR5
    24. Saccharomyces cerevisiae YJM1460 SNR5
    25. Saccharomyces cerevisiae YJM1479 SNR5
    26. Saccharomyces cerevisiae YJM1549 SNR5
    27. Saccharomyces cerevisiae YJM1573 SNR5
    28. Saccharomyces cerevisiae YJM1592 SNR5
    29. Saccharomyces cerevisiae YJM1615 SNR5
    30. Saccharomyces cerevisiae YJM195 SNR5
    31. Saccharomyces cerevisiae YJM320 SNR5
    32. Saccharomyces cerevisiae YJM326 SNR5
    33. Saccharomyces cerevisiae YJM428 SNR5
    34. Saccharomyces cerevisiae YJM541 SNR5
    35. Saccharomyces cerevisiae YJM554 SNR5
    36. Saccharomyces cerevisiae YJM627 SNR5
    37. Saccharomyces cerevisiae YJM682 SNR5
    38. Saccharomyces cerevisiae YJM693 SNR5
    2D structure Publications New